Language

Speaking to others as humans comes naturally, I cannot imagine how we would work as a society without any type of language. Wether it is with our hands, written, expressions, and most importantly, by vocals meaning that we talk to one another through words that our ancestors made up and that we now are educated with to live our everyday life.

 1.-    The first part of this assignment required me to engage in a conversation but not use any type of language as in speaking, writing, or sign language. I decided to take the opportunity to engage in our daily lunch at work at the salon and try the experiment with co workers. I explained to them that it was an experiment for class and that i just needed them to act normal like if it were any other day. So me and the girls had a full conversation for about twenty minutes on what they did over the weekend. It was hard to not speak with words for I am a fairly talkative person and wanted to talk but could not. Instead, I went ahead and nodded, used facial expressions, and my hands as well- not to make sign language but actually thumbs up and thumbs down. I found this experiment difficult but in a way that at many times i wanted to speak out loud to give my opinion on what we were talking about but could not since I had to remain quiet at all times. The impressions of my co workers were surprised for some did not think i could manage to stay quiet past five minutes. Others, wanted to laugh at the fact that i was not speaking and made such funny faces at times. They did not alter the way of communicating, on the other hand, most of them got the hang of what i would try to say or express even though there were a few giggles since it felt like we were playing pictionary.  The culture i think that would have more advantages would be the speaking culture rather than a symbolic culture because they can use hands, words, expressions while symbolic culture cannot communicate with words.
     There are individuals in our culture who do not get the chance to speak for they had complications in their lives that made them not be able to communicate speaking languages. However, thanks to American Sign Language they have the ability to communicate with an alphabet made with hand gestures. This affects those who do speak because they may not know that the other person cannot speak but in an effort to make the non speakers feel comfortable, they try to find a way to communicate even with simple gestures. I think in our society people who do have the privilege to speak find it a bit awkward when interacting with someone who cannot communicate with words. Personally, i treat everyone the same, and when i encounter someone who does not speak but uses ASL instead, i take the extra time to understand what they are trying to explain as best and courteous as possible.


 2.-   In the second part, i was asked to talk but not use my hands, gestures, any facial expressions, or any difference in my tone of voice. This was HARD! I can be quiet for a while, but to talk and not express in my tone how excited i may be or sad, was tough, as well as not using my hands! I tend to express or do some kind of movement with my hands at almost all times when I'm talking it just comes naturally. I was able to last the fifteen minutes but like i said, it was hard to do so, i wanted to quit and just use my hands but i didn't. It was so boring to talk monotone and not be able to express how i really felt and that was what i found most difficult for me. I did the experiment with my co workers again and this time, they could not help but laugh on how serious i was being since I'm not much of a serious person at times, i think this definitely did make a difference in how they would communicate with me since half of them left the room because of how serious the look on my face was.
    I think what this experiment said about how we use signs in our language is that it plays a huge role in our everyday life and it is a very important factor to communicate effectively with others. If we all did not express how we felt by using our hands, raising our voices, or facial expressions, we would be boring! Not only that, but the way we communicate would not be the same and would definitely not mean the same to us as it does today.There are people who have difficulties reading body language, take for example people who cannot see.  There are advantages to that being that sometimes its better not to see what people are doing and disadvantages being that for that same reason, the other person can be doing something mean and you are not aware of it. It definitely makes quite the difference and i believe that we should all just treat one another with nothing but respect.

Piltdown Hoax

The Piltdown hoax is one of the most known scientific hoaxes of all time. In 1912, Charles Dawson, a paleontologist had contacted Arthur Woodward about findings of what could be human ancestor skull bones that Dawson had dug up. Other countries had their own skull structures and when the Piltdown Man was discovered was right after these countries already had theirs. In that same year, 1912, was when the rest of the parts were found that formed a skull for the Piltdown Man. However, years later it was discovered that the Piltdown Man was a fraud. It was actually the skull of a female orangutan whose skull was broken apart, and teeth were filed down. Forty years later the truth was found out but no one knows exactly who is responsible for the hoax itself. There are many suspects but no one knows exactly who is fully responsible for falsification of the so called "piltdown man". The remains were only about 100 years old and not even human related. The human faults that came into place in this situation would be self pride, and the fact that these people truly thought no one would notice that it was a fraud. Self pride i believe was the human fault that played the biggest role because other countries had found skulls and bones and i feel that the paleontologists of England felt like this was a race and that they needed to prove they too found remains of ancestors in their country as well to not be left behind and to look smart as well. Also, i think that whoever is fully responsible for the hoax, truly thought no one would find out the truth about the situation, when in fact people did find out the truth. Positive aspects of the scientific process that helped reveal the skull was a fraud would be the technology improvements that were made. The fact that the microscopes could detect that the teeth were filed down was a big help. As well as the chemical improvements such as being able to check the skull remains and examine them carefully with the lab materials. I think people don't have to necessarily remove the "human" factor to reduce chances of errors instead i think people should be honest and do their work able to be supported by facts, tested, and proven  that they are true. What I learned from this historical event regarding taking information from unverified sources is that as humans, we are gullible. Sometimes not intentionally but we do believe what people say and do without facts and i think we need to start to have facts and test what people tell us is correct and prove it for ourselves in order to not be as gullible.

Comparitive Primates : Locomotor Patterns

Before I begin comparing and contrasting these five types of primates, I wanted to go ahead and explain what exactly is a Locomotor Pattern. A locomotor pattern are methods that animals use to move around such as swimming, walking, jumping, and swinging.

Lemurs :
Many lemurs live in the tropical rain forests of Madagascar. They are herbivores and eat form the forest trees and plants. Lemurs have "dental comb" teeth that are used for grooming and feeding. They use their hands and fingers to help them climb trees. However, their locomotor pattern is found in their legs, which is used for jumping. Since lemurs find it hard to travel through ground by walking, many of these species travel by hopping on their feet, using them the most. This trait has been influenced by their environments because it as adapted from ancestors of lemurs and since they found walking trough land hard, the lemurs started to jump and used that as a way to get around.

Spider Monkeys:
The spider monkeys live in tropical rain forests of central and South America, they are omnivore creatures and eat nuts, fruits, leaves, bird eggs, and spiders. Their locomotive trait is their long lanky arms and gripping tails which help them move from branch to branch. The fact that they travel through trees, made it unecessary to use their thumbs since they hold on mainly with their tails. The lack of thumbs is a result of adaption to the environment. Their tails resemble fingerprints and that is what allows such strong grip. These traits show that the adaption to the environment had an important influence on the species.

Baboons:
The baboons live mainly in Africa or Arabia, they prefer the savanna and semi-aird habitats. They are the largest monkeys and do not have gripping tails. They eat fruits, grass, seeds, birds, rodents, and small antelopes. These animals do not have gripping tails but can climb trees to sleep and eat in. Their locomotive trait isthat they are quadrupedal primates. They walk on all four and are adaptable to any environment because they mainly just need water, somewhere to sleep, and tall trees. The baboon travels by foot most of the time and this is influenced by where they live because they live in savannas, therefore, do not need to be going from tree to tree so often.

Gibbon:
The Gibbon can be found in southeastern parts of Asia, they eat fruits, parts of trees, plants and leaves. They live mainly on trees and go from tree to tree meaning that they have powerful shoulder muscles, long arms, and curved fingers. The curved fingers is a result of the adaption to the environment and their locomotion os swinging or brachiating. They adapt to living in trees because due to their long arms and curved fingers, these primates can not swim, causing them to travel from tree to tree. Its traits have been influenced by environmental adaption because since they are on trees so often, their fingers are curved for a better grip which helps them swing as well.

Chimpanzee:
The chimpanzee prefers to live in the forest life, rainforest and wet savanna to be exact. They eat fruits, plants, eggs, and carrion. They have the thickest body, long arms, and NO tail! These primates spend their time in land as equally as in trees. Their locomotive pattern is that they mainly walk on their knuckles, or in all four , legs and arms. These primates can walk on all four, upright, and can swing from tree to tree. Their traits have been influenced by their surroundings since they can travel almost anywhere, they can eat and live almost anywhere as well. The chimpanzees adapt tools, just like humans, they use leaves as sponges when drinking water and are some of the smartest primates alive.

LEMUR

SPIDER MONKEY

BABOON

 

GIBBON

CHIMPANZEE

Analogy/Homology

Homologous :
A. - The two species that i chose have the homologous trait are the frog and lizard, both share their forelimbs  they are constructed the same yet serve different functions.These animals share same bones, humerus, radius, and ulna.
B. - The difference in structure is that the frogs rely and use their forelimbs to jump and to stay rested. While lizards use their forelimbs to run. These homologous traits show differences in structure between the two because they are used in different ways and at different times. They each use them regarding to their everyday needs and do not have the same purposes.
C. - The common ancestor of these species is the Eusthenopteron, we know that this ancestor possesed this homologous trait by studies of fossils from earlier times.

Analogous :
A. - two species that possess analogous trait are the Bird and the moth. Both species fly yet have different purposes and ways of surviving that differ.
B. - A bird and the moth both fly and use their wings to fly with. Although each use it for different reasons, they share the analogous trait that they have wings and each one has different purposes.

protein synthesis

DNA strand

ATTGTACACCTAATAGGATAGCCCCAGTTTGAATTGCGGGACTGCAATCGCCG

Historical Influences on Darwin

There were many influences upon Darwin's lifetime that encouraged him to publish his book, i feel that the person who had most influence on him was Thomas Malthus. Malthus was a political economist who was concerned with life at the time in England while Darwin was interested in how evolution happens. Although he unlike Darwin was not interested in species change, he was interested in the limits of human population growth. His essay "The Principle of Evolution" brought to Darwin's attention that in nature, populations increase in numbers when there is a lot of resources and little or no predators. Also, that population to increase in sizes held by availability of resources, as long as food and supplies remain stable. As an example, when Malthus was doing his studies on humans; producing more offspring that can survive establishes competitive environment among siblings, then produces variation among them which then creates some siblings to have greater chances of survival. I would argue that he had the most influence to Darwin's theory of Natural Selection because with the help of Malthus's ideas Darwin saw how selection in nature could be explained. Malthus observation in nature plants and animals produce far more offspring than can survive "struck" Darwin and made him see how selection in nature could be explained. Darwin saw that in struggle for existence those individuals who have favorable variations would survive and reproduce while unfavorable ones are destroyed. Darwin extended Malthus's discovery to all organisms, that population size is limited by resource availability, constant competition for food and water, making competition the key to Natural Selection.After reading from Malthus, Darwin himself stated that "Here then, i had at last got a theory by which to work". 

The points that most directly are affected by Malthus's work would start with all organisms have the potential of reproducing exponentially, this was influenced by Malthus because he believed that people and organisms could produce as much as they desired to, offspring would always be the result of mating which was his main worry overpopulation. Resources are limited is another as well as organisms with better access to resources will be more successful in their reproductive efforts because as long as the organisms are willing to do what is necessary for the resources, they will be successful in reproductive efforts, as for resources, they are limited and our planet can only hold certain amount of resources which then makes competition among the populations. Who gets access to these limited resources? is another one as well that Malthus could have influenced, by having more offspring establishes competitive environment, which then creates greater chances for surviving. 

Darwin could not have developed his theory of natural selection without the influence of Malthus and his ideas. Because even Darwin himself, saw that the ideas Malthus had enlightened him to discover what natural selection could start off as. Darwin went off of Malthus's ideas and further explored and researched how his essay and ideas could be applied to all organisms which helped Darwin realize just how natural selection could be explained. 

The church affected Darwin's publication of his book On the Origin of Species because questioning the church was a risky move in that time frame. People believed the church over anything else at the time and the theories that Darwin had went against everything taught in the church to people. The church was the strongest sense of power and once people had read Darwin's book, they would start to question the church themselves.

source : http://www.ucmp.berkeley.edu/history/malthus.html

life

it can have its ups and downs, and what you make with them is up to you. There isn't much to it besides that. When your having a bad day, be smart enough to know that the rest of the day might reward you with something great if you simply keep yourself to be more optimistic. Don't let one simple mistake at work, or school upset the rest of your day, it isn't going to do much of a difference, it is just going to bring you down even more to sit and complain about your day. Instead, make the best out of every day after all, you only get one life, you might as well enjoy every second of it.