Comparitive Primates : Locomotor Patterns

Before I begin comparing and contrasting these five types of primates, I wanted to go ahead and explain what exactly is a Locomotor Pattern. A locomotor pattern are methods that animals use to move around such as swimming, walking, jumping, and swinging.

Lemurs :
Many lemurs live in the tropical rain forests of Madagascar. They are herbivores and eat form the forest trees and plants. Lemurs have "dental comb" teeth that are used for grooming and feeding. They use their hands and fingers to help them climb trees. However, their locomotor pattern is found in their legs, which is used for jumping. Since lemurs find it hard to travel through ground by walking, many of these species travel by hopping on their feet, using them the most. This trait has been influenced by their environments because it as adapted from ancestors of lemurs and since they found walking trough land hard, the lemurs started to jump and used that as a way to get around.

Spider Monkeys:
The spider monkeys live in tropical rain forests of central and South America, they are omnivore creatures and eat nuts, fruits, leaves, bird eggs, and spiders. Their locomotive trait is their long lanky arms and gripping tails which help them move from branch to branch. The fact that they travel through trees, made it unecessary to use their thumbs since they hold on mainly with their tails. The lack of thumbs is a result of adaption to the environment. Their tails resemble fingerprints and that is what allows such strong grip. These traits show that the adaption to the environment had an important influence on the species.

Baboons:
The baboons live mainly in Africa or Arabia, they prefer the savanna and semi-aird habitats. They are the largest monkeys and do not have gripping tails. They eat fruits, grass, seeds, birds, rodents, and small antelopes. These animals do not have gripping tails but can climb trees to sleep and eat in. Their locomotive trait isthat they are quadrupedal primates. They walk on all four and are adaptable to any environment because they mainly just need water, somewhere to sleep, and tall trees. The baboon travels by foot most of the time and this is influenced by where they live because they live in savannas, therefore, do not need to be going from tree to tree so often.

Gibbon:
The Gibbon can be found in southeastern parts of Asia, they eat fruits, parts of trees, plants and leaves. They live mainly on trees and go from tree to tree meaning that they have powerful shoulder muscles, long arms, and curved fingers. The curved fingers is a result of the adaption to the environment and their locomotion os swinging or brachiating. They adapt to living in trees because due to their long arms and curved fingers, these primates can not swim, causing them to travel from tree to tree. Its traits have been influenced by environmental adaption because since they are on trees so often, their fingers are curved for a better grip which helps them swing as well.

Chimpanzee:
The chimpanzee prefers to live in the forest life, rainforest and wet savanna to be exact. They eat fruits, plants, eggs, and carrion. They have the thickest body, long arms, and NO tail! These primates spend their time in land as equally as in trees. Their locomotive pattern is that they mainly walk on their knuckles, or in all four , legs and arms. These primates can walk on all four, upright, and can swing from tree to tree. Their traits have been influenced by their surroundings since they can travel almost anywhere, they can eat and live almost anywhere as well. The chimpanzees adapt tools, just like humans, they use leaves as sponges when drinking water and are some of the smartest primates alive.

LEMUR

SPIDER MONKEY

BABOON

 

GIBBON

CHIMPANZEE

Analogy/Homology

Homologous :
A. - The two species that i chose have the homologous trait are the frog and lizard, both share their forelimbs  they are constructed the same yet serve different functions.These animals share same bones, humerus, radius, and ulna.
B. - The difference in structure is that the frogs rely and use their forelimbs to jump and to stay rested. While lizards use their forelimbs to run. These homologous traits show differences in structure between the two because they are used in different ways and at different times. They each use them regarding to their everyday needs and do not have the same purposes.
C. - The common ancestor of these species is the Eusthenopteron, we know that this ancestor possesed this homologous trait by studies of fossils from earlier times.

Analogous :
A. - two species that possess analogous trait are the Bird and the moth. Both species fly yet have different purposes and ways of surviving that differ.
B. - A bird and the moth both fly and use their wings to fly with. Although each use it for different reasons, they share the analogous trait that they have wings and each one has different purposes.

protein synthesis

DNA strand

ATTGTACACCTAATAGGATAGCCCCAGTTTGAATTGCGGGACTGCAATCGCCG

Historical Influences on Darwin

There were many influences upon Darwin's lifetime that encouraged him to publish his book, i feel that the person who had most influence on him was Thomas Malthus. Malthus was a political economist who was concerned with life at the time in England while Darwin was interested in how evolution happens. Although he unlike Darwin was not interested in species change, he was interested in the limits of human population growth. His essay "The Principle of Evolution" brought to Darwin's attention that in nature, populations increase in numbers when there is a lot of resources and little or no predators. Also, that population to increase in sizes held by availability of resources, as long as food and supplies remain stable. As an example, when Malthus was doing his studies on humans; producing more offspring that can survive establishes competitive environment among siblings, then produces variation among them which then creates some siblings to have greater chances of survival. I would argue that he had the most influence to Darwin's theory of Natural Selection because with the help of Malthus's ideas Darwin saw how selection in nature could be explained. Malthus observation in nature plants and animals produce far more offspring than can survive "struck" Darwin and made him see how selection in nature could be explained. Darwin saw that in struggle for existence those individuals who have favorable variations would survive and reproduce while unfavorable ones are destroyed. Darwin extended Malthus's discovery to all organisms, that population size is limited by resource availability, constant competition for food and water, making competition the key to Natural Selection.After reading from Malthus, Darwin himself stated that "Here then, i had at last got a theory by which to work". 

The points that most directly are affected by Malthus's work would start with all organisms have the potential of reproducing exponentially, this was influenced by Malthus because he believed that people and organisms could produce as much as they desired to, offspring would always be the result of mating which was his main worry overpopulation. Resources are limited is another as well as organisms with better access to resources will be more successful in their reproductive efforts because as long as the organisms are willing to do what is necessary for the resources, they will be successful in reproductive efforts, as for resources, they are limited and our planet can only hold certain amount of resources which then makes competition among the populations. Who gets access to these limited resources? is another one as well that Malthus could have influenced, by having more offspring establishes competitive environment, which then creates greater chances for surviving. 

Darwin could not have developed his theory of natural selection without the influence of Malthus and his ideas. Because even Darwin himself, saw that the ideas Malthus had enlightened him to discover what natural selection could start off as. Darwin went off of Malthus's ideas and further explored and researched how his essay and ideas could be applied to all organisms which helped Darwin realize just how natural selection could be explained. 

The church affected Darwin's publication of his book On the Origin of Species because questioning the church was a risky move in that time frame. People believed the church over anything else at the time and the theories that Darwin had went against everything taught in the church to people. The church was the strongest sense of power and once people had read Darwin's book, they would start to question the church themselves.

source : http://www.ucmp.berkeley.edu/history/malthus.html

life

it can have its ups and downs, and what you make with them is up to you. There isn't much to it besides that. When your having a bad day, be smart enough to know that the rest of the day might reward you with something great if you simply keep yourself to be more optimistic. Don't let one simple mistake at work, or school upset the rest of your day, it isn't going to do much of a difference, it is just going to bring you down even more to sit and complain about your day. Instead, make the best out of every day after all, you only get one life, you might as well enjoy every second of it.